This tools are designed to deal with polyploid wheat. The first tool is to design KASP primers, making them as specific as possible.

gem install bio-polyploid-tools

You need to have in your $PATH the following programs:

• MAFFT
• primer3
• exonerate
• blast

The code was originally developed on ruby 2.1, 2.3 and 2.5. It may work on older version. However, it is only actively tested in currently supported ruby versions:

• 2.1.10
• 2.2.5
• 2.3.5
• 2.4.2
• 2.5.0

To run PolyMarker with the CSS wheat contigs, you need to unzip the reference file from ensembl.

polymarker.rb --contigs Triticum_aestivum.IWGSC2.25.dna.genome.fa --marker_list snp_list.csv --output output_folder

The snp_list file must follow the convention ID,Chromosome,SEQUENCE with the SNP inside the sequence in the format [A/T]. As a reference, look at test/data/short_primer_design_test.csv

If you want to use the web interface, visit the PolyMarker webservice at TGAC

The available command line arguments are:

Usage: polymarker.rb [options]
    -c, --contigs FILE               File with contigs to use as database
    -m, --marker_list FILE           File with the list of markers to search from
    -g, --genomes_count INT          Number of genomes (default 3, for hexaploid)
    -s, --snp_list FILE              File with the list of snps to search from, requires --reference to get the sequence using a position
    -t, --mutant_list FILE           File with the list of positions with mutation and the mutation line.
    requires --reference to get the sequence using a position
    -r, --reference FILE             Fasta file with the sequence for the markers (to complement --snp_list)
    -o, --output FOLDER              Output folder
    -e, --exonerate_model MODEL      Model to be used in exonerate to search for the contigs
    -i, --min_identity INT           Minimum identity to consider a hit (default 90)
    -a, --arm_selection arm_selection_embl|arm_selection_morex|arm_selection_first_two
                    Function to decide the chromome arm
    -p, --primer_3_preferences FILE  file with preferences to be sent to primer3
    -v, --variation_free_region INT  If present, avoid generating the common primer if there are homoeologous SNPs within the specified distance (not tested)
    -x, --extract_found_contigs      If present, save in a separate file the contigs with matches. Useful to debug.
    -P, --primers_to_order			 If present, saves a file named primers_to_order which contains the KASP tails

The following formats are used to define the marker sequences:

If the option --marker_list FILE is used, the SNP and the flanking sequence is included in the file. The format contains 3 columns (the order is important):

• snp_name The ID of the marker. Must be unique.
• target chromosome for the specific primers. Must be in line with the chromosome selection critieria.
• sequence The sequence flanking the SNP with the SNP highligted on square brackets ([]) and the two alleles separated by a forward slash (/).

BS00068396_51,2A,CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTA[T/C]ATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA

If the flanking sequence is unknow, but the position on a reference is available, the option --snp_list can be used and the FASTA file with the reference sequence must be provided with the option --reference. This is to allow the use of a different assembly or set of contigs used for the discovery of the SNPs that are different to the reference given in the option --contigs. The format contains the following positional columns:

• scaffold The sacffold where the SNP is.
• reference allele The base in the reference (may or may not be the same as in the reference file.
• position Position of the SNP. The first base in the scaffold is base 1.
• alternative allele The base in the alternative allele.
• target chromosome for the specific primers. Must be in line with the chromosome selection critieria.

IWGSC_CSS_1AL_scaff_110,C,519,A,2A

This file format can be used with snp_positions_to_polymarker.rb to produce the input for the option--marker_list.

By default, the contigs and pseudomolecules from ensembl are used. However, it is possible to use a custom reference. To define the chromosome where each contig belongs the argument arm_selection is used. The defailt uses ids like: IWGSC_CSS_1AL_scaff_110, where the third field, separated by underscores is used. A simple way to add costum references is to rename the fasta file to follow that convention. Another way is to use the option --arm_selection arm_selection_first_two, where only the first two characters in each contig is used as identifier, useful when pseudomolecules are named after the chromosomes (ie: ">1A" in the fasta file).

If your contigs follow a different convention, in the file ChromosomeArm.rb it is possible to define new parsers, by adding at the begining, with the rest of the parsers a new lambda like:

@@arm_selection_functions[:embl] = lambda do | contig_name|
  arr = contig_name.split('_')
  ret = "U"
  ret = arr[2][0,2] if arr.size >= 3
  ret = "3B" if arr.size == 2 and arr[0] == "v443"
  ret = arr[0][0,2] if arr.size == 1   
  return ret
end

The function should return a 2 character string, when the first is the chromosome number and the second the chromosome group. The symbol in the hash is the name to be used in the argument --arm_selection. If you want your parser to be added to the distribution, feel free to fork and make a pull request.

##Using blast

To use blast instead of exonerate, use the following command:

./bin/polymarker.rb --contigs test/data/BS00068396_51_contigs.fa --marker_list test/data/BS00068396_51_for_polymarker.fa  --aligner blast  -a arm_selection_first_two

There was some strange issue with the numbering, so bumped to 0.9.7

• Moved the arm selection function for fields in the chromosome name to the ChromosomeArm class.

• FEATURE: polymarker.rb now also prints the total number of hits found.

• BUGFIX: priemr3.rb had a regression when adding the repetitive flag to the @values array. This lead to the wrong order of the columns in the output and possibly other secondary effects.

• Added the option --max_hits to polyamarker.rb to set a maximum number of bast hits to identify repetitive regions. This adds the column is_repetitve to the output. The mask is not calculated in repetitive regions and the primers are designed as non-specific.

• Added script ```tag_stats.rb`` That gets the descriptive statistics for a tag in a bam file for each reference.

ruby tag_stats.rb -b HI.3206.006.Index_2.CS_125RNA_14d_Leaf8.sorted.bam -r /Users/ramirezr/Dropbox/JIC/expVIPMetadatas/RefSeq1.0/Genes/annotation/IWGSCv1.0_UTR_ALL.cdnas.fasta --tag 'NH'

• BUGFIX: ChromosomeArm.rb was fixed to conform the module assumptions for the package.

• FEATURE: The functions to select the chromosome arm are now in lib/bio/PolyploidTools/ChromosomeArm.rb and the help message is updated automatically with the valid options.
• FEATURE: Added option filter_best to replicate the original behaviour of selecting the best hit of each chromosome. Still useful for assemblies which still contain synthetic duplications.

• BUGFIX: There was an error which prevented the correct localisation of the SNP in markeres with gaps in the local alignment before the position with the snp.
• FEATURE: PolyMarker now selects the best hit of the target chromosome. This improves the specificity in regions with a recent duplication. The drawback is that if your assembly has artificial repetitions, the primers won't be marked as 'chromosome specific', but as 'chromosome semi-specific '. In a future version this will be addressed.

• FEATURE: polymarker.rb added the flag --aligner blast|exonerate which lets you pick between blast or exonerate as the aligner. For blast the default is to have the database with the same name as the --contigs file. However, it is possible to use a different name vua the option --database.

• FEATURE: polymarker.rb Added to the flag --arm_selection the option scaffold, which now supports a scaffold specific primer.
• FEATURE: snp_position_to_polymarker Added the option --mutant_list to prepare files for PolyMarker from files with the following columns ID,Allele_1,position,Allele_1,target_chromosome.

• FEATURE: Added a flag min_identity to set the minimum identity to consider a hit. The default is 90

• BUGFIX: Now the parser for arm_selection_embl works with the mixture of contigs and pseudomolecules
• DOC: Added documentation on how to use custom references.

• Added flag genomes_count for number of genomes, to be used on tetraploids, etc.

• polymarker.rb now validates that all the files exist.
• BUGFIX: A reference was required even when it was not used to generate contigs.

• BUG: Blocks with NNNs are picked and treated as semi-specific.
• BUG: If the name of the reference have space, the ID is not chopped. ">gene_1 (G12A)" shouls be treated as ">gene_1".
• TODO: Add a parameter file to configure the alignments.
• TODO: Produce primers for products of different sizes. This can probably be done with the primer_3_preferences option, but hasn't been tested.